جداسازی و تشخیص مولکولی پاراکوویروس های انسانی از نمونه کلینیکی کودکان مبتلا به گاستروانتریت …

و توسط سمپلر سوسپانسیون می کنیم .
lµ ۲۵۰ از محلول NaoH/SDS (محلول S2) را روی آن ریخته و با سروته کردن مخلوط می کنیم.محلول بتدریج شفاف تر
می شود و به محض شفاف شدن محلول ها به مرحله بعدی می رویم. lµ ۲۵۰ از محلول S 3 را به میکروتیوب انتقال داد
ه و آنرا ۱۵ ثانیه ورتکس می کنیم و سپس برای ۱۰ دقیقه با سرعتg12000 سانتریفیوژ می کنیم . در این مرحله , توده
سفید تخم مرغی رسوب میکند وما فاز شفاف روئی را که حاوی پلاسمید است و حجمی حدود lµ۶۰۰ دارد بر داشته به
میکروتیوب استریل منتقل میکنیم. هم حجم آن ایزوپروپانول خنک و خالص اضافه کرده و به خوبی آنرا مخلوط می کنیم و
سپس یکساعت در دمای ۲۰- درجه قرار می دهیم.
– میکروتیوب ها را به مدت ۱۰ دقیقه با سرعت بالا سانتریفیوژ کرده و محلول روئی را با دقت خالی می کنیم. ml1 اتانول
۷۰٫/. را به نحوی در میکروتیوب ریخته که رسوب ته آن کنده شود و در داخل اتانول شناور گردد. – ۳ دقیقه با سرعت بالا
سانتریفیوژ کرده و محلول روئی را با دقت خالی کرده و میکروتیوب را به صورت وارونه روی دستمال کاغذی قرار می دهیم تا
الکل آن کاملا تبخبر شود. – قبل از خشک شدن کامل رسوبlµ ۱۰۰ آب مقطر (Nuclease free water) روی آن
ریخته و فرصت می دهیم تا رسوب کاملا حل شودOD پلاسمید استخراج شده را اندازه گیری میکنیم.
PCR (8-3 شماره یک:
طراحی پرایمر برای ناحیه ۵’UTR ژنوم پاراکوویروس تیپ یک با استفاده ازتوالی ژنوم پاراکوویروس تیپ یک موجود در بانک ژنی. طبق جدول شماره ۴ انجام شد.
جدول ۶: توالی و موقعیت پرایمرهای طراحی شده برای ناحیه ۵’UTR ژنوم پاراکوویروس

برای دانلود متن کامل پایان نامه به سایت azarim.ir مراجعه نمایید.

پرایمر برای ۵’UTR توالی موقعیت
PevsF1 CCACGCTYGTGGAYCTTATG ۵۵۳-۲۹۲
PevgR1 ACGGGTACCTTCTGGGCATC ۵۸۰-۵۶۰
PevgF2 TCACACAGCCATCCTCTAGT ۳۱۴-۳۳۴